Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14759F3
Clone ID IST14759F3
Vector VICTR76
Project tigm

Sequence tag IST14759F3HMR1
Sequence
CAACCNCATAGTGGTTTACAACCATCTATAATGAGCTTTGGTGTCCTCTTCTGGCATGGAGGTACTACATGCAGATAGAG
CATTCATATGCAT
Sequence Type genomic DNA
Unitrap ID UNI9268

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65727130..65727222 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032386 (Trip4) NM_019797 thyroid hormone receptor interactor 4 Gene [Source:MGI (curated);Acc:Trip4-001]


Sequence tag IST14759F3BBF1
Sequence
GTTGCTGGGATTTCAACTTAGGACCTTTGGAAAAACAGTAGGAGCAGATGGCTCTTAACTGCTGAGCCGTCTTTCCAGAA
GGTAGTTCTTAATATTTACAGTCAAGACAAGAAGTCAGACAGAACTACGTTCAATTAAAAATTAAATCACTATTTTCATC
CCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCA
GGGCTACACAGAGAAACCCTGTCTCGAAAAACAAAAAAAAAAAAAAAAAAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65727219..65727510 292
 
EST/CDNA Est Name
  CA564872.1 - CA944189.1 - BY273886.1 - BY258403.1 - CD555218.1 - BY300014.1 - BY069747.1 - CJ072922.1 - BY055123.1 - BY053750.1 - BY124108.1 - BY786388.1 - BY124162.1 - BY307019.1 - BY052443.1 - BY024045.1 - BY128418.1

 
Come back to gene CA564872.1 - CA944189.1 - BY273886.1 - BY258403.1 - CD555218.1 - BY300014.1 - BY069747.1 - CJ072922.1 - BY055123.1 - BY053750.1 - BY124108.1 - BY786388.1 - BY124162.1 - BY307019.1 - BY052443.1 - BY024045.1 - BY128418.1


For any suggestions or comments, please send an email to unitrap@crg.es