Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14373H11
Clone ID IST14373H11
Vector VICTR74
Project tigm

Sequence tag IST14373H11HMR1
Sequence
TTCCTTTAAAAAGTCTCGCCCTAACGTTCCAAGGTTGGCTGTTTTCTGCACGACTCCTTTCATTCGCTTTAAATTTAGAG
GACATTGCGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI11712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61715867..61715963 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024576 (Csnk1a1) NM_146087 casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]


Sequence tag IST14373H11HMF1
Sequence
NAAAGTGTTCTAACTGGAAAAAGAAACCCGGGTTAAATTTAAGAAATACAAAGAAAACCACGGCGATCATACGACTTCGC
CCTTCTCATCTTAAATAACTGTTCAAGTGAGATACTTTGAACAAGGTGGAAAACCTCAGANTTNACCCTGACTTTCTATC
GGGTTTTTCCTTTTTAGGGAAATAAGTGGGGGAGGCTGCTAAGCCNGGAAAACCGGCTCGCTCCGGACTCCCCTGTGCGT
GCGTGCGTGCGTGCAGTGGGAANANGCTCGGANTACTTANNGGGGTTGGGGTGAAAAAAAAAGCCCANCGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61715558..61715868 293
 
EST/CDNA Est Name
  CX734444.1 - AA030352.1 - AA014055.1

 
Come back to gene CX734444.1 - AA030352.1 - AA014055.1


For any suggestions or comments, please send an email to unitrap@crg.es