Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13172G1
Clone ID IST13172G1
Vector VICTR74
Project tigm

Sequence tag IST13172G1BBF1
Sequence
CCATGTGCAGGATCTGGCAGAGATGAGTGAATGAATGATCCCGGTTTTGTTTTGTTTGTTTTTACACCTGGAGATCAGGT
TCCCAGAAGCTAAGGTTTGCCCTGCGTCTCGAATGCTACTGAGACCCTTGTGGCTCCTGGTCTAGTGCTTAACTGCCAGA
TACCAACAGTGACCTTGGCTGTTTGCCCAGCATCAGGGACCCACAGGGCACAGAGGTGAGCCCCCCAGGGGTCAGGTCAC
CGCAGGACCGGCATACAGGACGGGACAGGATCAAGAATGTCTACGGGCATATAGAACAGTCCCCAGACCCTCATTTGTTT
CAGGGCTCNNAGTCTGGTTGCATCANGGACGGAGGGCACTCCAAGGCTTGAGGGCCTTGGGCTTNNNGCGGTCTCCCACT
CACTCCCGGGANAAGCTCCTGCCACGGGTGGAAGTCTGAAGAGCAAGAACACATGCAGCCCATTGCAGGANANGGAAAAC
AGANGCTCANCAAANANAACGANGTGTGGCTGTGACCNAGCGGANNNNNNGCATTGACTTCTTGCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 137034522..137035068 505
NO GENE  


Sequence tag IST13172G1HMF1
Sequence
ATGCCTCGAGCTGTGACTTGGTGGGGTGAGAACTGGGTGAGGTTTATGGTGGANACACTCAATGACTTAACACGTGCCAN
TTACCCACATTTAATAGCATTGAGACCCAAGGACGGAGTCTCACTGGCTCTGCCAGCCTGTGG
Sequence Type genomic DNA
Unitrap ID UNI35346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122472848..122472989 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es