Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13122B6
Clone ID IST13122B6
Vector VICTR76
Project tigm

Sequence tag IST13122B6HMF1
Sequence
ACACAGGGTGCTGCCTCAGCCCCTCTGTGCTTCTGCCTGTTCCANAGGCTGTCAGGTTCTCTGGCGCACCCTCTCACCTG
TTCANACTAATTTCCTAAGTTCGGCGGGTCCCGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCAG
CTGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACAGGGTGCTGCCTCANCGCCTCTGT
GCTTCTGCCTGTTCCAGAAGCTGTCAGGTTCTCTGGCGCACCCTCTCACCTGTTCAGACTAATTTCCTAAGTTCGGCGGG
TCCCGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTANGCNGCCTCCNNANCNNNNCNGNCACCTGTCCTCCGGTCCNN
ANNGTGGCTGNNTGTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13122B6BBF1
Sequence
ACACAGGGTGCTGCCTCAGCCCCTCTGTGCTTCTGCCTGTTCCAGAGGCTGTCAGGTTCTCTGGCGCACCCTCTCACCTG
TTCAGACTAATTTCCTAAGTTCGGCGGGTCCCGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTANGCCNCCTCCCCAN
CTGGNTGGGCACCNGTCCNCCNGTCNNGANNGNNNCN
Sequence Type genomic DNA
Unitrap ID UNI10434 UNI22960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 50942698..50942882 171
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13981545..13981729 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48497273..48497457 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022652 (Morc1) NM_010816 microrchidia 1 Gene [Source:MGI Symbol;Acc:MGI:1316740]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 26337316..26337500 171
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40233482..40233666 171
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 80851586..80851770 171
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 77338408..77338592 171
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 94475522..94475706 171
 
EST/CDNA Est Name
  CA585513.1 - BX512183.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 48814348..48814532 171
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 111071282..111071466 171
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 84329711..84329895 171
NO GENE  

 
Come back to gene CA585513.1 - BX512183.1 - AW320348.1


For any suggestions or comments, please send an email to unitrap@crg.es