Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14908D7
Clone ID IST14908D7
Vector VICTR76
Project tigm

Sequence tag IST14908D7HMR1
Sequence
TTTTAACTNNGCTTCGAACTTACTGGAACATGACAAGGCCTGGGCCTGCGAAGAAATANCAAACAGACGACACCGGTAAG
GGCAGGGAAGGATATGGGGGTACTGGCACCCAAACCCTTGCAGCAGCCATGCAAAGCTTGGACCAAGAGTGTTGGCACTG
CTAAGGACACCTCTTCCTTTGGTCCATAATCTGCCGTTGAGTCGTTTACCTGTGGCTGGCTTCTACCTGCTTCTATTTCA
GGGTTGTTCTTTCTCGATTCTTTTTTCANGGTGCTAAATGCNCACCCACTAGCTCTTGGTGGTANGCAAGCTCTACGGTG
AANCCNNTTNCNNANGTTCCNNNNTTTACGTTTCTTTGGTTTCACAGCGGTATCACTACATTCTTGTGGACCAGTCCTTG
AACTGGGCCGANTGGTNNCCNCAGACCTCNNNANAGAANGNNCTCNGNNCNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14908D7HMF1
Sequence
AAAGCTGAGCAAGAAGAGCGGAAACGGGAGGAGGAGGCCCGGAGGCTCCGCCAGGCAGCCTTCCGGGAGCTCAAGGCAGC
TTTCAGCGCGTAGTCCTGCTGACCTGACCTTTGACCGCGGCTGTGCCTTACTAACACCCTGGAGGTGATGACCAGGATTT
TTCACATTTTTATCCCTGCAGCCCTCTGCTCAGATGACCTCCCCTTCACGGCCCAGGCCTGTTTCTTAGTGCTTCTGGAT
AACCAGTAACTTGCTTTCGTCCTTCCCAGGGTCCTGGTCCCTTCCAAACGGTTTGCCAGCCAGCCTTTCCAGCCTTCACC
CCTCTGCTGTTATCTGTANATTCGTTTCTTCTTGGNNNCNNTATTTATCCCTGCGGANTCCTATGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI35348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 89206278..89206667 376
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026255 (Efhd1) NM_028889 EF hand domain containing 1 Gene [Source:MGI (curated);Acc:Efhd1-001]

 
Come back to gene ENSMUSG00000026255


For any suggestions or comments, please send an email to unitrap@crg.es