Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10672A8
Clone ID IST10672A8
Vector VICTR76
Project tigm

Sequence tag IST10672A8HMF1
Sequence
CTGTTAATTTACACTCAGCANANACGGTTAATAAAACTGGGGAATGAGCATGGACTCACAGTGAGAAGTTCACCGGAGGC
AAAGTTGCTCCCGCTTTGAAGAACTCTTTACTCTGTTCTGGGAACATGTACGGATTATCCCCTGGTGTCAATTTGGGGAT
TCCATTTCTGGGATCAATATCTGTGGGAAATGTCAGAAAACATCACACATCAGGCTGAAGCCNATGCCCTGTCTGCTGTG
AGCAACAACCTGACAGTGAACAATCCGGTCCCTTCATGTTTATCGCAAGATAAATTTGTTATCCCGCCTTANGAAGTTAA
AGTTCATGGGACTTTTTTCCCCATGCTGTGTTCTCANATATGATTACTTAAAAACATGGAGGGCCGCNNAANANCAGCTG
TGGAGAGCCNTCCCCTGGATGANGCGTGGCTGTTGCTCACACAGGCTCACAGCGGCTGTGCAAGANTTGCCAATTACATT
TTTNAGCATANGTTGGTTGGGANTAGCTTCTGANNNCCTGGGGANCTGNTGGNCAGTTGATACCCTCGANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45590981..45591528 505
 
EST/CDNA Est Name
  BI100822.1 - BY719067.1


Sequence tag IST10672A8BBF1
Sequence
CTGTTAATTTACACTCAGCANANACGGTTAATAAAACTGGGGAATGAGCATGGACTCACAGTGAGAAGTTCACCGGAGGC
AAAGTTGCTCCCGCTTTGAAGAACTCTTTACTCTGTTCTGGGAACATGTACGGATTATCCCCTGGTGTCAATTTGGGGAT
TCCATTTCTGGGATCAATATCTGTGGGAAATGTCAGAAAACATCACACATCAGGCTGAAGCCNATGCCCTGTCTGCTGTG
AGCAACAACCTGACAGTGAACAATCCGGTCCCTTNATGTTTATCGCAAGATAAATTTGTTATCCCGCCTTANGAANTTAA
AGTTCATGGGACTTTTTTCCCCATGCTGTGTTCTCAGATATGATTACTTAAAAACATGGAGGGCCGCANNANANCAGCTG
TGGAGAGCCNTCCCCTGGATGANGCGTGGCTGTTGCTCACACAGGCTCACAGCGGCTGTGCAAGATTTGCCNNTTACATT
TTTNAGCATAGGTTGGNTGGGANTAGCTTCTGAGNNCCTGGGGATCTGTTGGCAGNNNATNNCCTNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10672A8HMR1
Sequence
ACAGTACTTAGGTATTTTGTTACGTATCTTGGTGTGTCTGTGTGTGTTAAAAGCACCTATTTATGCAGGAGTGTATACTC
ACACACGTGTATGTGGAGGCCACAGGAGGATACACAGTGTTTTTCTCTATTGCTTTCTGCACTTATGTTTTTANACTGGA
TTTCTCTGAACCTAGAGCTTGACATTTTGACCAGGTCAGTTGGCCTGTGAGTATCTANGATCTGCCTGTCTCTGCCCCTA
TCGCTGGGGTCACAAGCATACCCAGTTGTGCNNGGNTTNNANNNNGGTGCTGNNAANNNGANNTNCANANCNNGN
Sequence Type genomic DNA
Unitrap ID UNI30065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45590693..45590984 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es