Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14519C11
Clone ID IST14519C11
Vector VICTR74
Project tigm

Sequence tag IST14519C11HMF2
Sequence
CTATGGAGCCGAAGCTGGACTTCACTACTGATCTTTCTGTGTCTGTTTTCCAAGTACTGGGATTACAGACTCTAAATCCA
AGCGAATAAAGAGAAGAGTTTGAAAGTAAACAATTAGAGGCATAGTATGATGTAAAAAGAAATAGCTTATGACAGAAAGA
CCACAAACATATAAGGAATCATATATATACATATATACATATAAGGAATTTTTTTAAAAAAACCCATCTCTCCCATTCCA
ACAAACAGAAACCCACCAAGATGTAAGACTGGTGTTCAGCAATTTTCTCCTACACCGCTGTCTCTAATACACACTCTTTG
AACCTTGATTTAGAACAAGGCTTTGAGAGTTTTCTTAGTTGTTGTAAACACCAACCCTAAGCAGTCTGACATGAGTTAAT
TTCAGAAAAGACACAAAGAAGGAAGCCATGTGAAAATACCANGACTTACAGTTTTCCTCAGCCTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106575767..106576232 464
 
EST/CDNA Est Name
  AK084527.1 - AK169431.1 - NM_001032378.1 - BC085502.1 - BC008519.1 - NM_008816.2


Sequence tag IST14519C11BBF1
Sequence
TTCACTGTGGTAGGGGNNAGGAGAGCTGTTTAATACACAGGAGGAGCCCAGCCAAATCAACTACCCACTCCAGTTGGACA
TTAACCAGGATTTGAAGCCCATTAGCTGGTGTAAAATCTCTGTTTTCAGGCTGGAGAAATGGCTCAGCAGTTAAAAGCAC
TGACTGCTCTCCTGAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTTACAACCATCCGTAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106525129..106525363 229
NO GENE  


Sequence tag IST14519C11HMR1
Sequence
ATAGGAGTTTGAGGGAGGCCTGAGCTACTACGTGAAACAGTACAAAACCGACTCCCAAAAAATAAAAACTTAAAAAAGTA
TTTTTTTTTCCTTTCNCTTGTTTTAATTTACAAATGANACTCANTTC
Sequence Type genomic DNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106575645..106575770 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es