Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12301D8
Clone ID IST12301D8
Vector VICTR76
Project tigm

Sequence tag IST12301D8HMF1
Sequence
CCTTTTTTGTTTGTTTGTTAAATGTTCCTTGTTTGTTTGTTTGTTTGTTTGTTAAATGTTCCCTTTTTTTTGGTTTGTTT
GTTAAATGTTCCTTTTTTGTTTGTTTGTTTGTTAAATGTTCCTTTTTTGTTTGTTTGTTTGTTAAATGTTCCTTTTTTGT
TTGTTTGTTTGTTAAATGTTCCTTTTTTGTTTTGTTTTGGTTTTTTGTTTGTTTGTTTGTTAAATGTTAAATGGTTTTAA
AGGTCTGATCCNCCTGACNCCC
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106587032..106587292 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST12301D8BBF1
Sequence
CCTTTTTTGTTTGTTTGTTAAATGTTCCTTGTTTGTTTGTTTGTTTGTTTGTTAAATGTTCCCTTTTTTTTGGTTTGTTT
GTTAAATGTTCCTTTTTTGTTTGTTTGTTTGTTAAATGTTCCTTTTTTGTTTGTTTGTTTGTTAAATGTTCCTTTTTTGT
TTGTTTGTTTGTTAAATGTTCCTTTTTTGTTTTGTTTTGGTTTTTTGTTTGTTTGTTNGTTAANNGTNAAATGGTTTNAA
AGGTCTGATCCTCCTGACTCCNCANNANCTNANATTGCCCGGGTGAACCNCCNCNCCNNTTNNNNNGANNTTTNGNATGN
NACCCNGGACGCNNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es