Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14209B11
Clone ID IST14209B11
Vector VICTR74
Project tigm

Sequence tag IST14209B11HMF1
Sequence
GTACTGTAAACCTAGTCAAGAGCTGGGGGCTGGAGAGGTCACAGGCCCTTTTTTTTTNNGGANGANCATGTGTTCAAATA
NCCTTTGGAGCACTCATGTTTCTGTCCATAATTCANTGCCGTGAGCTTTCATCAAAAAAGCTTCTCACTGCNCCGGATGG
TGGTTAATGAAAAAACTCCTAACTGACAAAATTGCTGANAGTAAGGGATGTTCAANTTCANCCCTAAATGCNACAGCNNC
AAAAACCCATTTCCCAGGCTTGGNAATATCAAAATGGGTGAAAAGGGAAAANCTGGGGGCTGGANAGGTATGCTGTCAAA
AAAGCCTGACCNCTTCACNAACAAACTCATTGCAACTCNGCTTATCTACNTANNACTGGTACAANACTGGGGANANCCAA
CAATTTTNCNNCCTGNNAGGGGGAANGNCNCNTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14209B11HMR1
Sequence
GTACTAAGTGTGGATTCCCCGTGTGGAGTGGGCTTCACATCCACTTACAGCGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI20160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 97981437..97981492 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000881 (Dlg3) NM_016747 discs, large homolog 3 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg3-003]

 
Come back to gene ENSMUSG00000000881


For any suggestions or comments, please send an email to unitrap@crg.es