Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14724H3
Clone ID IST14724H3
Vector VICTR76
Project tigm

Sequence tag IST14724H3HMR1
Sequence
AAATCGACTGTATTATTTTAAAGTTCAAGGGTCATAATTTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54034498..54034539 42
NO GENE  


Sequence tag IST14724H3BBF1
Sequence
GATTTATTCTCCTGTTAAATAATTTCTGGAGTTACATACAGCACACTGCACACCTAGACATTCAGTTCTTTAATGAGTAG
ATGTAACCAATTGTGATTGTGTTGGCTGAATATATTCTCATTTTAACCAGTTCTAGCTTTCAGTCATTTACCTTCCAGTG
AAGTAATACTAAAGCCACCCAATCNATAGCATCATTAATTGTCCTAAGTTCTGTGGGGGCTATCTCTGCNCGAAGCCCTC
CCCTCTGTCTGTGTTANACCTTATTACATAAGTCCTGGATGTTGACAGGATACNAATGCACATGCACATGTGAGGAAGTG
AANGACTCCCNAAAGGANTGTGTGTGTCCTCNCATGTAAGTNAN
Sequence Type genomic DNA
Unitrap ID UNI35352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54034535..54034896 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es