Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3308-NR
Clone ID PST3308-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3308-NR
Sequence
CCACGATAAATGATTGGATGTGGATCCTCTGCCAAGATAATTTGTTATATACTATTGTGCTTTATTATAGTTTTTTGACA
GTGTTTAAATGATTATGTTTCAAATTGAGTCAAATGTGCTAAAATTAATTATTTTAGGGAGCCGAAACTCTACTGAATGC
ACACTTATCCTGACTGAGGGAGACTCAGCAAAAACTCTAGCCGTTTCAGGCCTTGGAGTGGTTGGAAGAGACAAATAT
Sequence Type genomic DNA
Unitrap ID UNI15581

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98872277..98872514 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]

 
Come back to gene ENSMUSG00000020914


For any suggestions or comments, please send an email to unitrap@crg.es