Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12143E6
Clone ID IST12143E6
Vector VICTR76
Project tigm

Sequence tag IST12143E6BBF1
Sequence
GAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTCTGTANACCNNGCTGGCCTCNNNCTCNNANNTTTG
CCTGCCTCTGCCTCCCAAGTGCTGGGATTATAAATTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12143E6HMF2
Sequence
NNNACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGCACA
Sequence Type genomic DNA
Unitrap ID UNI9937 UNI29612 UNI30954 UNI30955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 447228..447264 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 77844..77880 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053211 (Zfy1) NM_009570 zinc finger protein 1, Y linked Gene [Source:MGI Symbol;Acc:MGI:99212]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47061425..47061461 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 31821905..31821941 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15676362..15676398 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5376043..5376079 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 54159061..54159097 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21321547..21321583 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 28224208..28224244 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72953462..72953498 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22678664..22678700 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 41481630..41481666 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 96526958..96526994 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23257264..23257300 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031478 (Nek3) NM_011848 NIMA (never in mitosis gene a)-related expressed kinase 3 Gene [Source:MGI (curated);Acc:Nek3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 90944535..90944571 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20087864..20087900 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23369049..23369085 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 58879596..58879632 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050812 (AI314180) NM_172381 Proteasome-associated protein ECM29 homolog (Ecm29) [Source:UniProtKB/Swiss-Prot;Acc:Q6PDI5]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 73313937..73313973 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12848209..12848245 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24757804..24757840 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036893 (Ehmt1) NP_001012536 euchromatic histone methyltransferase 1 Gene [Source:MGI (curated);Acc:Ehmt1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10228967..10229003 37
NO GENE  

 
Come back to gene ENSMUSG00000036893


For any suggestions or comments, please send an email to unitrap@crg.es