Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12001C7
Clone ID IST12001C7
Vector VICTR76
Project tigm

Sequence tag IST12001C7BBF1
Sequence
ATACGTGGCTCCANACNATCCTANGTCAATGAGACTATACATAANATTTGTTTGTGTTTGTTTGTTTGTTTGTTTGTTTG
AATGGAAAATTTGGAACTGTGTGTAAGGGCTCGTTTTCCATGATGTGTGGTGGTTTTGTTTGTTTGTTTGGTCTTTTTGT
TTTGTTTTATTTTTTGTTTTTCCTTTACTTATTTGANCACACCCTTGTTTTCCCACTGTAATTTTTTTTTATTGTCANTC
AAGGCCAAGGTGCTGCTCTGCANTTGANANAACTCNCTCATTAAGAAGGGTCTGANCCACCCGGGCGTGGTGNCNCACNC
CTTTAATCCCANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12001C7HMF1
Sequence
ATACGTGGCTCCANACNNTCCTANGTCAATGAGACTATACATAAGATTTGTTTGTGTTTGTTTGTTTGTTTGTTTGTTTG
AATGGAAAATTTGGAACTGTGTGTAAGGGCTCGTTTTCCATGATGTGTGGTGGTTTTGTTTGTTTGTTTGGTCTTTTTGT
TTTGTTTTATTTTTTGTTTTTCCTTTACTTATTTGAGCACACCCTTGTTTTCCCACTGTAATTTTTTTTTATTGTCNGTC
AAGGCCAAGGTGCTGCTCTGCANTTGANAGAACTCNCTCATTAAGAAGGGTCTGANCCACCCGGGCGTGGTGGCGCACGC
CTTTAATCCCANCNG
Sequence Type genomic DNA
Unitrap ID UNI32681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66394387..66394717 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054598 (9130230L23Rik) RIKEN cDNA 9130230L23 gene Gene [Source:MGI Symbol;Acc:MGI:3041166]

 
Come back to gene ENSMUSG00000054598


For any suggestions or comments, please send an email to unitrap@crg.es