Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10997C11
Clone ID IST10997C11
Vector VICTR76
Project tigm

Sequence tag IST10997C11HMF1
Sequence
AACCCACCCCTGCCCTCACCTCCCTCCACCTTTTCCTGCAGATGTGGACGAATGCCAACTCTTCCAGGACCAGGTGTGCA
AGAGCGGAGTGTGTGTGAACACGGCCCCAGGCTACTCTTGCTATTGCAGCAACGGGTTCTACTATCACGCACACAGGCTG
GAGTGCGTTGGTATGAGCCCCACCTTCCCCACCCCCAATTCTGGA

Sequence Type genomic DNA
Unitrap ID UNI10748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28094271..28094474 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es