Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2290-NR
Clone ID PST2290-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2290-NR
Sequence
GTTTGTTTTTTTAATTTTCGCGGAATGGCTTGGTCGCTCAACTGAGTCTTGGGCACAGGGTGGGGTCACGGCAAAATAGG
GTTAAATTTTTTAGTTTGATAATAGTCGGTTTGAACATTATGGTGTATAGTAGGGAAGACACTTAAATGGCTTATTAAGT
AGGGTTTTCATTTCGGAAGTGTGAAGTTGAAGAACTTACTGAGTGTATGTCCTCAAGGTTGTATGTTGTATGTCCCTTTT
AGTAAAGATTCCTTTTAACGCCAGG
Sequence Type genomic DNA
Unitrap ID UNI3589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29170348..29170600 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071172 (Sfrs3) NM_013663 splicing factor, arginine/serine-rich 3 (SRp20) Gene [Source:MGI (curated);Acc:Sfrs3-001]

 
Come back to gene ENSMUSG00000071172


For any suggestions or comments, please send an email to unitrap@crg.es