Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3082-NR
Clone ID PST3082-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3082-NR
Sequence
TTAGTGATAATAGAAAACTGAAAAGGGAGAATTCATTTCAAAGTCAGCTGCTGTGGTGAGTTACAGATGATTTAGGCAAG
AATCATAGTAGTGTTAAAATTGGTTGGGGAATAGATTAACAAACTCAAGTTTTACTCCCTAGATCTCTTACTAATTACCA
AGAAAAACAATCTTTACCAGGGAGAAACTTGGTTTATGGCATCTTAATCAACTTGGTGAAATTTTATATTCAGTTTTGTG
ACTTTGCTGTGGACTTCCT
Sequence Type genomic DNA
Unitrap ID UNI15583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24846232..24846489 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006715 (Gmnn) NM_020567 geminin Gene [Source:MGI (curated);Acc:Gmnn-001]

 
Come back to gene ENSMUSG00000006715


For any suggestions or comments, please send an email to unitrap@crg.es