Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10740E12
Clone ID IST10740E12
Vector VICTR76
Project tigm

Sequence tag IST10740E12HMF1
Sequence
AGCTAAGAAGCTGTCCCATCCCCCCAAACCAACAGAGCTGTTGCACCACTGAAGCCTGGTCTCTGGCCCCGCCCTAAGCC
ACAAGCACACACCCTAGCTAGAGCTAAAGTCAAGCCTCCACCCAGCCCCACACCGCAAACGCANCTCAGCTCGGGAGGGG
AGAAGGCTGAGTGGACCTGGGGTCTGGAAAACCTGTTGGCCCCGCCTGCCGGTTCACTGTCTTATCTCCACCCACTGCTC
CCCACCCAGTCACTGAAGACTCTGCCTCAAACGGTCCTGGGTTGTTCTTCCAAGTCACCTCCTTANACCCAGCGATGCAA
GGCTTGTCCCCCACAAGTGAGCTCCAGCTCCTGANATCTTCAGGGCTCCTGCACGGGGAGTATAGGAGTCTGTCCTCGTC
GCCTCCGTGATGTAGCATGCGGAGGGCTACAGGGGACTGCAACTGGA

Sequence Type genomic DNA
Unitrap ID UNI16185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25940864..25941309 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074274 (D930028M14Rik) RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]

 
Come back to gene ENSMUSG00000074274


For any suggestions or comments, please send an email to unitrap@crg.es