Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14207D12
Clone ID IST14207D12
Vector VICTR74
Project tigm

Sequence tag IST14207D12HMR1
Sequence
AGATAACATGAACTCTTAAGCGAGTACATTCTCTTATAAAAAATGATAGAATTATATGAAATATTAGGAATCTAGGCCCA
AGAAATAGAAAATATTGGTAGCAGGCAATGATAGATGTACAGTTAGTGTGGGAATTTTCTATTTTGAAAGTTAATTTCTN
ACACAAAGTATTTTGAACATCTAGTACTTAAAAGGTTAGGCTGGGACACAGTANAAAGTTATTCTAACTAGGTTCAATTA
TCATAAATGTTAAAAATAANTGGAANAGACAGATTTTGTTTGTTTTGGGGATGGTTCTNNAGATACNTNCTGTAATTTTT
CAATTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66651031..66651359 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


Sequence tag IST14207D12BBF1
Sequence
ATCTGATTATATGAAATATGTTAACATGATAGCTATCAAGTTAGCGTATTTCTACAATGAAAAATTTTCATATTATACTT
CTACTTGTTTAGCATTGGTAAATGAGAGAACACTGGCTCCTTCTCAAAAGGACTTTCAATCTTTGGACATTTTCTGTTTC
TTGTCCNAACACTTCAGGCCNAAGCATCAAGGATAACCCCCCCCCCCCNAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66650819..66651034 210
NO GENE  

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es