Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12090E1
Clone ID IST12090E1
Vector VICTR76
Project tigm

Sequence tag IST12090E1BBF1
Sequence
TTGGTACAGAAATCAAAATGCAGTTGTATACTCTGAAAGCAGTGCAAACATGGCTGCCAAATGCCTGCTGCTCAGAACTA
CAACTCCCAGAATGCAGTGCTGGGGAAGTTTCTCTGACCAGGGTTTGAAACAACCACACTGGCTTCCTTGTAGTCCAACC
TCCCAAGCGGCTGCTGCTGCTGCTGCTGCCATGAAGGCTCTTCTAGCAGAAGCAGGTGCAGTGTTCTGCCTCAGATCTGT
C
Sequence Type genomic DNA
Unitrap ID UNI29712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40204768..40205007 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]

 
Come back to gene ENSMUSG00000040111


For any suggestions or comments, please send an email to unitrap@crg.es