Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14504G9
Clone ID IST14504G9
Vector VICTR74
Project tigm

Sequence tag IST14504G9HMF1
Sequence
NCCNTGTGGTTGCTGGGAATTAAACTCANGTCCNCTGGAANAGCAATCTGTGCTCNTAACTGCGGAGTCNTCTCTCCNGC
CCTATAAAGATATTCTTAATGACNTAAACCATGAANATTAAGGGAGAAAGANAACAGGAANACNGACNGNNTTAANTCTC
TCTANGTGTCNCTNGGGANANANGTTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14504G9HMR1
Sequence
NNGAAAACTCCAGAAACCTTTCTTAAAGCTAANAAAACCN
Sequence Type genomic DNA
Unitrap ID UNI27936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28920634..28920670 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026803 (Ttf1) NP_033468 transcription termination factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ttf1-001]


Sequence tag IST14504G9BBF1
Sequence
ACCANGNGGNNNCTGGGAATTAAACTCAGGTCCTCTGGAAGAGCAGTCTGTGCTCTTAACTGCGGAGTCATCTCTCCAGC
CCTATAAAGATATTCTTAATGACATAAACCATGAAGATTAAGGGAGAAAGAGAACAGGAAGACAGACAGAGTTAAGTCTC
TCTAGGTGTCGCTAGGGAGAGAGGTTGAAGGGAAGCCTGAAGAGCAAGCCATGCCCAAGAAGGAGGGAGAAGAAGGGAAG
GAAGGGGTGAAGCGGGCAAAGCGAGGGAGGAGGAGGAAGGGACAGGAATGTCTAACTATGGGGTAGCCTAATCACATGGC
CCCTAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29403109..29403439 321
NO GENE  

 
Come back to gene ENSMUSG00000026803


For any suggestions or comments, please send an email to unitrap@crg.es