Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2635-NR
Clone ID PST2635-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2635-NR
Sequence
AGGTGATCCAAATGATTTTCTCATCCGTAGATGAGTGGGCTTTTAACCTTGGCTTGGGTGGACATGGACCCGATTCCTCC
CGTGGGTA
Sequence Type genomic DNA
Unitrap ID UNI15586 UNI15587 UNI15588 UNI15589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 29634..29720 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 37660..37746 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 818370..818456 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41030986..41031072 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061132 (Blnk) NM_008528 B-cell linker Gene [Source:MGI (curated);Acc:Blnk-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4539003..4539089 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 14235960..14236046 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 25522449..25522535 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55707650..55707736 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3508559..3508645 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52080855..52080941 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19315301..19315387 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53603970..53604056 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19089671..19089757 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24579024..24579110 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41656619..41656705 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115778874..115778960 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 12079152..12079238 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37174610..37174696 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 19083157..19083243 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3331243..3331329 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17364944..17365030 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 15121748..15121834 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7471243..7471329 84
NO GENE  

 
Come back to gene ENSMUSG00000030321


For any suggestions or comments, please send an email to unitrap@crg.es