Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14792A3
Clone ID IST14792A3
Vector VICTR76
Project tigm

Sequence tag IST14792A3BBF1
Sequence
CCAGGACTTGGTCATCTTTCTACGGGGTTTTAACTGGAGCATGCAGAGAGGCGGCGGGCCCATGACGTCATGGTTAAAAT
CCACACTCACTGATTTTGGACAAGCTCTGTATCACTGTCATCCAAAGCACACAGTAAGTATCCCTGCTCCTCAGTCTCAC
GGACCAGCATTCTCATCGCCATTAATTTTGTGCACCCAAGTCACGGCCCAGCAAGGGCATTCCCTTCCCATCGGCTTCCC
TTATGGATNAAGGCAGANGCCTGATCCNAATCTCTGCCGCGGCCCTCGTCTTCGCATGGGCGTAAGANTGTAAAGTCTCT
TTGACTCCNACCATCCTTTAATGATCNAAGANGTGGCCTCTCGGGCTTTTATTTGGCTGANCAAAGCCCTTANCCTGGGT
CCCACACACCATCCACTCNAATCCNANANTGCTNANCACCNGNNCTTTTTAGTTCCGTATTAAAACTGNCTGTGTNCNAN
NCNTNGTCCATTTANNNACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14792A3HMR1
Sequence
NNNGGGAGTGAGGCTGCCTGCTTGGCCCTGGCTGGCTCCTGCTCTGCCCCGCAACTCTGACTGGGATCTCCACTGTCAGA
ATCCTCTGCTTATCTGTTGAGGGTAAACAGAAGCAGATGCGCTGTGAGCGCCCTTCGGGGGGGTCACAATCCCAATTTGC
CCGTGGCTCAGTGACATACAGACCTCTGGTTCTGTGAAGTGTTTTTAGCTTGTTCTGACCAANANAATTTTCNACATATT
C
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114689062..114689298 231
NO GENE  


Sequence tag IST14792A3HMF1
Sequence
CCAGGACTTGGTCATCTTTCTACGGGGTTTTAACTGGAGCATGCAGAGAGGCGGCGGGCCCATGACGTCATGGTTAAAAT
CCACACTCACTGATTTTGGACAAGCTCTGTATCACTGTCATCCAAAGCACACAGTAAGTATCCCTGCTCCTCAGTCTCAC
GGACCAGCATTCTCATCGCCATTAATTTTGTGCACCCAAGTCACGGCCCAGCAAGGGCATTCCCTTCCCATCGGCTTCCC
TTATGGATCAAGGCAGANGCCTGATCCAAATCTCTGCCGCGGCCCTCGTCTTCGCATGGGCGTAAGANTGTAAAGTCTCT
TTGACTCCNACNATCCTTTAATGATNNAAGANGTGGCCTCTCGGGCTTTTATTTGGCTGATCANAGCCCTTANCCTGGGT
CCCACACACCATCCACTCAAATCCNAGANTGCTTANCACCNNANCTTTTNAGTTCCGTATTAAAACTGNCTGTGTCCCAA
TCC
Sequence Type genomic DNA
Unitrap ID UNI32259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114689297..114689778 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052724 (AC163344.2) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C9E7]

 
Come back to gene ENSMUSG00000052724


For any suggestions or comments, please send an email to unitrap@crg.es