Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14158G12
Clone ID IST14158G12
Vector VICTR74
Project tigm

Sequence tag IST14158G12HMR1
Sequence
GATGGAGGTGCAGCTTCCTCATCCATTCNNAAATGTAAAAAGGATACACAGAAATGTTCTGAACATGGCTGTTGTCAGCC
ACAAGCTGTAAACTTTCCCAGCGTGAATTGCAACATTGCTATCCTGAAGTAAATAAACAGCGGTGCGAAAGCCTAGACCC
GGCTATCANCAGCAACAGCAGAGTGGGGCCCANGAACATCACATCAGGAGAAACTATGCAAAGACAGCACCGTGCAATCT
CCTTTCTGTGTACTTCGAAAGGAGCCTGTTTGTCTGTCTGTTAAAATTGAGGCTGTTTCATATCCTTAGGGGAAGGAAGG
TCACAACCTGACCGANGCACTTANAGCTTCANAAGGTGGGGTGCGGCTCCTGCTGGGACANGANCACATGCNTGCNCTCN
CTN
Sequence Type genomic DNA
Unitrap ID UNI22700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91720213..91720615 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058240 (Cryzl1) NM_133679 crystallin, zeta (quinone reductase)-like 1 Gene [Source:MGI (curated);Acc:Cryzl1-003]


Sequence tag IST14158G12BBF1
Sequence
CATCCNCCTAGCAGGGAGGTAACAGGAACCATGGAAACTGTACCTTACAGGGGNNAANNNNNTAAGCACACAGTACCAGG
GGNNANNNNNNTAAGCGCACAGTACCAGCTGGGCTGGAGCCTCGGCAGTCGTTACTTANAACTGTCACAGGAGTGATTTT
TCTACTGAGCTACTGCTAGGATACACTCACCTGGAACTACAAAACTTTCTCCGGTGGGACTGACTATTCANTTGCANATA
NATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000058240


For any suggestions or comments, please send an email to unitrap@crg.es