Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14814D6
Clone ID IST14814D6
Vector VICTR76
Project tigm

Sequence tag IST14814D6HMR1
Sequence
GAAGAAGTGAGGAACATGGAGTATTCGAGGAGGTGATGGGCGGGGCTCATCCCCAGCCGGAAATGAGCTGAGGAGGGGGC
GAGTGGTGCGCTGAAGATGAGATTAGGGTTTGTCAGAGGAACTTAGACATCACTCACATTAATGGAGCANCCCANCAAGG
AGCCTCGTTCCAGGGCCTTTANAATGATCTGGTAGAGGTCGCTGGGGGCCTTCTGCAGGTCGTACCACTCAGTGACCCCA
CCGGTAAAGTCCTCGAAGGCCTCTGANGTGCANCCTCCCGAAAGANCCTCATANCTGCCATTCACTCTGTGGGCAGCTCC
ANGTCGGTTANTANCATCATCAAGGAGGACCGGGTANNANGGCCNNGACAACCNCNNCANCCCCNNANANNNAANATGTG
CCCTGGGGATCCTACTCACTTANCATANNCTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14814D6HMF1
Sequence
CTTCCTTCAAATCTCAGCGGTGCCCCAGCTCCTCAGCTCCCTCCTGCTCCCTCCCTTCTCATTCTTGTCTGTTTGTCTGT
TTGTTTGTTTTTATTTACTGTGCATTGGTGCTTTTCCTGTATGTATGTCTGTGTGAAGGTGTCAAGTCCCTGGAACTGGA
ATTACAGACAGCTGTGTGCTGCCGTGTGGGTGCTGGGTATTGAACCTGGGACCTCTGGGAGAGCAGCCAGTGCACTTAAC
ATTGAGCCATTTCTTTAGGCAGCACATATACTACAATTGGAACAATATGGAGTANATTANCCAGGCCTTCATTCTTATGA
CCTTCCCGTGTTCCAAGGCTCTCCCAGTCCAGTGCTTCAGCCTTCTGATGCAATCTCTTTCCTATTCTTGACTTCACCCA
CGCCTGGCTCCTTCTCCTTTCCTTTCTCCTTGCTTACCGTTGTCTGGCCCACAATTCCNACANTNNCTTCTAGCCCTCCC
TANCCCCGTGCTTGGTCNNNCCNCACCANCNTCCTGNCNATCCTTGA
Sequence Type genomic DNA
Unitrap ID UNI33147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6010356..6010881 496
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024942 (Capn1) NM_007600 calpain 1 Gene [Source:MGI Symbol;Acc:MGI:88263]


Sequence tag IST14814D6BBF1
Sequence
CTTCCTTCAAATCTCAGCGGTGCCCCAGCTCCTCAGCTCCCTCCTGCTCCCTCCCTTCTCATTCTTGTCTGTTTGTCTGT
TTGTTTGTTTTTATTTACTGTGCATTGGTGCTTTTCCTGTATGTATGTCTGTGTGAAGGTGTCAAGTCCCTGGAACTGGA
ATTACAGACAGCTGTGTGCTGCCGTGTGGGTGCTGGGTATTGAACCTGGGACCTCTGGGAGAGCAGCCAGTGCACTTAAC
ATTGAGCCATTTCTTTAGGCAGCACATATACTACAATTGGAACAATATGGAGTAGATTAGCCAGGCCTTCATTCTTATGA
CCTTCCCGTGTTCCAAGGCTCTCCCAGTCCAGTGCTTCANCCTTCTGATGCAATCTCTTTCCTATTCTTGANTTCACCCA
CGCCTGGCTCCTTCTNNNTTNNNTTCTNCTTGCTTANCNTTGTCNGGNNNAN
Sequence Type genomic DNA
Unitrap ID UNI33147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6010435..6010881 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024942 (Capn1) NM_007600 calpain 1 Gene [Source:MGI Symbol;Acc:MGI:88263]

 
Come back to gene ENSMUSG00000024942


For any suggestions or comments, please send an email to unitrap@crg.es