Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13384C1
Clone ID IST13384C1
Vector VICTR74
Project tigm

Sequence tag IST13384C1BBF1
Sequence
GGCTCAGTGGGTAANAGCACCCGACTGCTCTTCCAAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAAC
CATCTGTAACAAGATCNGNCNNNGTCN
Sequence Type genomic DNA
Unitrap ID UNI11991 UNI15874 UNI30929 UNI32895 UNI32896

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 30300703..30300798 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 77274093..77274188 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21873427..21873522 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061544 (BC043476) BC043476 protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q80ZY7]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82702069..82702164 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103146956..103147051 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7315769..7315864 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117444500..117444595 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64908992..64909087 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032393 (Dpp8) NM_028906 dipeptidylpeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1921638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 29457529..29457624 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23711442..23711537 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13143966..13144061 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72757062..72757157 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29611966..29612061 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053898 (Ech1) NM_016772 enoyl coenzyme A hydratase 1, peroxisomal Gene [Source:MGI (curated);Acc:Ech1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138321734..138321829 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 87226835..87226930 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082443 (AL954813.14)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86728807..86728902 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 130624502..130624597 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126843365..126843460 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001998 (Ap4e1) NM_175550 adaptor-related protein complex AP-4, epsilon 1 Gene [Source:MGI (curated);Acc:Ap4e1-001]

 
Come back to gene ENSMUSG00000001998


For any suggestions or comments, please send an email to unitrap@crg.es