Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10874A4
Clone ID IST10874A4
Vector VICTR76
Project tigm

Sequence tag IST10874A4HMR1
Sequence
NNTGTGGTTGCTGGGATTTGAACTTCTGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCC
CCAAGTTTGATTTTTTTAATGCTTTATTTTGAAACAAGAGCTCATTAAGTCACCCATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 82947717..82947854 138
NO GENE  


Sequence tag IST10874A4BBF1
Sequence
ACATGGTGGCTCACAACCATCCGTAACAAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI12672 UNI30731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26417983..26418018 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20308862..20308897 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34849562..34849597 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580682..55580717 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6042438..6042473 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030984..18031019 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es