Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5604-NR
Clone ID PST5604-NR
Vector U3NeoSV1
Project escells

Sequence tag PST5604-NR
Sequence
TCAGGAAGTAGTGGGCTTGCCTGAGCTGGACATGATGGCACGCGCCTGTAGTCTGAGGAGGAGAGCAGACTCAGTGATAC
TCA
Sequence Type genomic DNA
Unitrap ID UNI5544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72434741..72434822 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es