Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10867D3
Clone ID IST10867D3
Vector VICTR76
Project tigm

Sequence tag IST10867D3BBF1
Sequence
CTCCGCTTTTGCCTTTCCATCTTAACCCTGACNTCCCCACCGCTGCTCCCTTGCAGGTGCCCCGTGCTCCAGCCAGCTTG
CCTCCTCACTTTCCTGGGCATTCCTCCGAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI15182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43572532..43572645 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es