Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12835D2
Clone ID IST12835D2
Vector VICTR76
Project tigm

Sequence tag IST12835D2BBF1
Sequence
CAAGGAGGAGTACTTCCTTGGGCTGTCACATTAACAGCTAGATGCAGGCCTCAGAAAACATGGCTGCCAGACGGGGCAGC
CTCCAGCTGAAAGGAACCTGAAGAGATGGGCTCTTTGGCCAGCAAAGACGCTCTTACAAAGGCAGCTTCACAGCCCAAGC
ACATCCATTATGTAGAAAGCACCAGCCCCTCCCTGCAACAGGCCCTGTCAGCCTCCCCACAACCCCCTTCTGTGTCTCCA
GGGATTCGGCCTCTGCACATTTCCAGGAGTGGGAGGAGGGCCTGACTCAAGGTCACCANANTCCANGNNNGANANGGNAG
GANAGTTTCAGGTTTCCCNNCTCCGGCTCANGCTCANCNTCCCCTCCTGTGTGTNCNNCACNNGGTTGGNNACNNACNNN
ANCTNANTTTTGACNGNCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12835D2HMF1
Sequence
CAAGGAGGAGTACTTCCTTGGGCTGTCACATTAACAGCTAGATGCAGGCCTCANAAAACATGGCTGCCANACGGGGCAGC
CTCCAGCTGAAAGGAACCTGAAAAGATGGGCTCTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI21830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35191625..35191742 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041445 (Mmrn2) NM_153127 multimerin 2 Gene [Source:MGI Symbol;Acc:MGI:2385618]

 
Come back to gene ENSMUSG00000041445


For any suggestions or comments, please send an email to unitrap@crg.es