Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14846D2
Clone ID IST14846D2
Vector VICTR76
Project tigm

Sequence tag IST14846D2HMR1
Sequence
CCTTTCCCCCATCTCCTCCCCCTTCTCTCTCCTTCCTTCTCTTTTTCTTTTTGAGGCAGGGTCTTTCCCTGGCCTCCAAC
TCACCANNNNAGTTGGTGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121250674..121250776 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14846D2HMF1
Sequence
GTTCCAAGGGCCTCTGCAATATTGGGCAAGCATGTTACCTCTGATCTATGTGTCCAACCCCTTTTTTTTTAAAAAAAAAA
AA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56725645..56725725 81
NO GENE  


Sequence tag IST14846D2BBF1
Sequence
GTTCCAAGGGCCTCTGCAATATTGGGCAAGCATGTTACCTCTGATCTATGTGTCCAACCCCTTTTTTTTTAAAAAAAAAA
AAAAACAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56725637..56725725 85
NO GENE  

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es