Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0441
Clone ID GC0441
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0441
Sequence
CTGTGCGAGGCCGCTTGTCCTCTTTGTTAGGGTTCTTCTTCTTTGGTTTTCGCCCCCTGCCCACCCACTGTGCTCTTCCT
GTTCTCTTCCTTATCTTCCTTGCGGTTGGGGACCACAGGACTTGGTGGTGGCTGCTGTGGTGGAGGAGGAGCTGG
Sequence Type mRNA
Unitrap ID UNI273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12209614..12209707 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es