Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12072F8
Clone ID IST12072F8
Vector VICTR76
Project tigm

Sequence tag IST12072F8BBF1
Sequence
AAGGTATGTACCACCAAGCTCAGCAAGTAACTTTTTATAGATCCGATGGGTTTTTTGTCTTCATGGATGTATGTGCACCG
GTCAGAAGAGGCCATGCATCCCCAGGAAGAAGCAGAGTTAGAGGTGACTATGACCGCTCAGGTAGGCGCAGGGAACAGAC
CTGGGACCTCTGCAAGAGCAGCAAATGTCTTAACCACTGAGCAATCTCTCCAGCCTCAGTAACACACACACACACACACA
CACNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5289286..5289528 243
NO GENE  


Sequence tag IST12072F8HMF2
Sequence
AGATCACCCAGCGACAGTGGAAGGCAGAAGGTGTAGCAGAGGCCTTCAGCCACTTCTTGAAAGTCTTCTTGTGTTCAGTG
GCTACTGAGGCACTTGGAGATAGGGAAGGAGACTCTACAGCGCTCAGGTATCAGGGCCTGAAAAGTAACTCCTCTATCTG
CACTCAGAGGAGGGAGCATACTTCCATGGGGCAAGGAAAATGGGAACAGCTGAAATACTACCACTCTTTTGCTTCCAGAG
TTGGAAGAGAACTCCTGGTTTTCCTGACCCAGCACCAGAGAGTAGCTGTCCCAGGGCTCACCCTTCTTTCAGGACAGTTC
ANAGTCTCTCAAGANAATAAGATAGAAGATTCCTGAAATAACCNATAGCCACTTCCTTCAACCTCCAGCCCGTTGTGAAC
TATGGCCTTCCTGNNNNNNNNNTTNNNNNNNANACCNNATATTTTTGGAGGTCTGACTTANNTGGTGCTGANTCTCTATG
CCCTCCACCCAGANACCCTCTTTTNNTGGG
Sequence Type genomic DNA
Unitrap ID UNI11918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37106884..37107392 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es