Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059D6
Clone ID IST15059D6
Vector VICTR80
Project tigm

Sequence tag IST15059D6BBF1
Sequence
AGGATGGCGCGCGCTGAGTTAAACTTGGTGAGGCTCGTACCTTGAAGAAAAGAAGCAGATCCATCCGGCCGGGACAGCAG
GTTTTGCTCACAAGCAAAGTGCCGGAGACTGCAGACTGGACTTCGGGGGCTGGACTCTGTTCCGGTGTCAGTGAGTAAAT
TGGCGTCTGCACGCTTTGCGCCCTCCATAGCCGCTGACCACGCGCGCTGCGGCTCCCACCGTAGCTTCCGCTTAGCGGCG
CGCGCAGTTCTACCGGCCGCGTACCTATTGCGCATGCGCCCGTCTAGGGCACGCCCGAGTTGGCCCTANCACGTGGCTCA
GCGTTTACTAACAATCTGGTCCCGCCCACCTCCACCTCCCAATTCTGGCATANCCNTTGGACAACAGGGAACAGGGGGAG
GGACTTGGAGAGGGCCCATTTNGNNCANGGCTCCGGGTCCTGAACCCTGANNGTTCAAGTTANGTTGTCCNTTTANTTGN
NTGANNTANGAGCNACNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26443947..26444442 460
 
EST/CDNA Est Name
  BM941381.1


Sequence tag IST15059D6HMR1
Sequence
NCCTCACCGAANAAGGGTTTTTGAANAGCGGTTACTGTGTAGTATGTAACCAAGTACGCCCGCCTCCTTGAACTTATTTC
TAGATGTTGAGTATACCCACCTCCCGTCTCGAGAAGAAATGAGTT
Sequence Type genomic DNA
Unitrap ID UNI3462

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26444440..26444563 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061286 (Exosc5) NM_138586 exosome component 5 Gene [Source:MGI Symbol;Acc:MGI:107889]

 
Come back to gene ENSMUSG00000061286


For any suggestions or comments, please send an email to unitrap@crg.es