Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0365
Clone ID AF0365
Vector pGT0lxr
Project sanger

Sequence tag AF0365
Sequence
GGTGAACAGCCCGGGGGCCGTCAGGGTTGTCCACGCGTAAACAAGTCGGGCTTTTTTTTTTTTTTTCCTTCCGTCCCTCT
CTTGTTCCGCATTCTATTACGATTATTCCGTCGCTCTTCAACACCTCTTCCAGTCTTTTTCACTTGACTTCAGGGTTTCG
GAGAGATAAGGCGCTTGGCCCCTACTAACTGGACTACAAAGAGCTGGATCGGACCGGAACCACATGGCTCAACTCGCCCG
AGCCACCCGCTCCCCGCTGTCATGGCTGCTGCTGCTGTTCTGCTATGCACTCCGGAAAGCGG
Sequence Type mRNA
Unitrap ID UNI2865

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20506302..20506463 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040511 (Pvr) NM_027514 poliovirus receptor Gene [Source:MGI Symbol;Acc:MGI:107741]

 
Come back to gene ENSMUSG00000040511


For any suggestions or comments, please send an email to unitrap@crg.es