Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10458B4
Clone ID IST10458B4
Vector VICTR76
Project tigm

Sequence tag IST10458B4BBF1
Sequence
GGAATAAATACACACAACCGCTGTGGTTCTGAGGACATGGTGGCTGTGGGAGAAGGGAGGTGATTTGCATTTTGAACATG
TTCTTAATTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165683915..165684014 100
 
EST/CDNA Est Name
  CJ169184.1


Sequence tag IST10458B4HMR1
Sequence
NCNNNTCNCNNNNNNNNANNGGNGTNNGGNNNNNNTGCNNNNNNNANNTCNNNGNNNGCCACACGGCAGCCGAGGGTGAT
GAATTAGATAGATCTAAGGCCTGTGGATACGAGGCCGGCCCGGCTCTTCCTGGCCNATC
Sequence Type genomic DNA
Unitrap ID UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165683780..165683860 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es