Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14840D7
Clone ID IST14840D7
Vector VICTR76
Project tigm

Sequence tag IST14840D7HMR1
Sequence
GTGNNNNTTATGGTAACATTTCTATGTTGCTCTGGACCAATCGTATCTACTGGAACCATCTGCAGTGGTAGAGATCAGGC
ACTTGTGATATTTGAAATGTGGATAGTGATACTCCAAAATGAAATTCTAAGTTTTCATTAATGCTACTAGTCCTAGGTCT
GGGAGTTACTTTGTTGCAAAGTGAAGGTTTCTTTTCTCTTCCTCANAGATGGTCATTTAAAACAGCCATGAACACTTGTG
GCCN
Sequence Type genomic DNA
Unitrap ID UNI32838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103798028..103798263 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]


Sequence tag IST14840D7HMF1
Sequence
NTNGNNNNNNNNANNNGTNANNNTNCTACACTATNNNNTCCNATGANNCTTGCNNCNCATGCCTGTNATCCCNGCACTTG
GGAGGCNNANGCNGGAGGATTTNTGANTTCTGANTTCNAGGCCNGTCTGGTCTACNNAGTGANTTNNNNGACNGCCNNGG
CTNTNCNNANAAACCCTGTCTCNAAAAACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es