Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11850H1
Clone ID IST11850H1
Vector VICTR76
Project tigm

Sequence tag IST11850H1HMF1
Sequence
TCACAAGGTATCAAAGCCGGGCCAGCTCTGACACCCTGATCTCATGAGTAACAGCCTTGTGCTCCCCGATGGCCTAATCT
GCTCCAGGTGTTAGATTTTGTAGCCTGACTAAAGATGAAACTAGGAGCATCGTCATGGGCTTCAGCATTGATGTGGAAGG
ATGACTAATTTATTGCAGTTGCTAATGAGAAGCAGAAACCGATGTGTCTTGACTTGAACTCAGCCCTTTGGAGGGTCAGC
ACACTTTTTCCTAGAACATCCAGTAAACTGGGTGGTTTCTAGGGAACCATTCCTGGTTGTATGTTTAAAGAGTTCTTAAT
ATTTGATCCNCAACGTAACATATTTAGTGGCAAAAGCCATTGTACCTGGCGAGGGGGGTAACAGTCTCGGTGTGGCTGAN
AGCNNTCGTACCTGGCNAGGGGGTAACAACGTCGGCGTGGTTGTGATGGCTATTCATTCTTCTGATGCTGAACATTCNTT
CNNATACTTTTGCCATGCAGANTTNNNNNCTTGACAGTGTCNGNTN
Sequence Type genomic DNA
Unitrap ID UNI12637

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102951061..102951581 493
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]


Sequence tag IST11850H1BBF1
Sequence
ATGGGTGCCTGTACACACACACCATGCACACACACTCACATGGGANATTGTTTTATTATTATTTTTTANNNTTTCCAAGT
AATGACAGTGTTCTGATTTATCTCTCCCCTTTACAACCAAGTAAAAACATTCCTTCCCTATANAANTTTTTTATATATTA
TTTTANCTTCAAGAACTACAAAATATATTGACNTTAAAAATTGAAATGTTGGGGCTGGTGANATGGCTCAGCGGGTAAAA
NCATCANCTGCTCTTCCGAAGGTCCTGANTTNNNATCCGANCAACCACATGGTGGCTCACAACCATCTGTAATGANATCT
GT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es