Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4686-NL
Clone ID PST4686-NL
Vector U3NeoSV1
Project escells

Sequence tag PST4686-NL
Sequence
GCGGCAAAGAGCTATCCTCTACAAGCGGCTCAAAGTCCCTCCTGCCATTAACCAGTTCACCCAGGCCCTGGACAGGCAGA
CAGGTGAGGTTCCGGGCCCCAGAGCCAGAAACTGGCCCCGAGTTTGCCCTTACTGCAGTGCATGGCCACACTAATACAGC
TATGAAGAGAGAGGTGGAAGGGGGTCCCCAGTCCCTCCACCTGGAATGGGCGGGATTTGGTGAGGAAGCAGTTGAGGAAG
GATCCCCGTGTTGACCTCCTGCC
Sequence Type genomic DNA
Unitrap ID UNI15310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26767009..26767271 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062647 (Rpl7a) NM_013721 ribosomal protein L7 Gene [Source:MGI (curated);Acc:Rpl7a-001]

 
Come back to gene ENSMUSG00000062647


For any suggestions or comments, please send an email to unitrap@crg.es