Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4632-NL
Clone ID PST4632-NL
Vector U3NeoSV1
Project escells

Sequence tag PST4632-NL
Sequence
GTTTAAAAGAAGGGAGGTTGGGTTAAATTTTGGGTTAATTTGATAGTTTTAAAAAAATTAAAACCAGGGGGGGGTTGGTG
ATTTTTTTTTTTTTACAAGGTAAAATAGCCAGTACTTGAACCTGCCTGAGATTCTTGCTTAGTAACGTGACTGCATAACA
CTGATAACACTTAGGGCTCATGCTGAGCTCTTAACCCACCACTGACCTATATCTGAACCCCTACATTTTTTTTAAAATAA
AAAAACTACCTGATAATCCTGATATTAAAAGT
Sequence Type genomic DNA
Unitrap ID UNI15599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91426813..91427033 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es