Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11532F5
Clone ID IST11532F5
Vector VICTR76
Project tigm

Sequence tag IST11532F5HMR1
Sequence
TTGAACAGTACCGATTGACTGGCTAGCACTGACATTATTTTTTGAAACCATAAACGTATTGCCCGCCCCACCGTCAATGT
AGTATTTTTGATCCATCTTGCTTATTTTCCATTATCACTGTTTTAAAAACCTCTCTGAGCTAACCACACTCCTAAGATTG
TCC
Sequence Type genomic DNA
Unitrap ID UNI7975

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118006877..118007038 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039163 (Cmc1) NM_026442 COX assembly mitochondrial protein homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915149]

 
Come back to gene ENSMUSG00000039163


For any suggestions or comments, please send an email to unitrap@crg.es