Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12529D6
Clone ID IST12529D6
Vector VICTR76
Project tigm

Sequence tag IST12529D6HMF1
Sequence
CTANAAGCCCCTGCGGGCCCGCGTGCGTCCTGGGGCCTGANTGTGGAGGCCGAGGAGGAACGGTGGCGGCCCCTGCTGTT
GCTGCTGTTGCTGCTACTGCTACCGCCGCCGCTGCCGCCTCTGTTTCTGACCCCCTTGTGCCCATCCCAAGAGGGAGGTC
ANAGTGTCCATGTGCCTAACGGGAAACAGGAAGGAGTACACTCTTTAGTGTCTGTCCCGGCCCCAAAGGGCTCACATTCC
TATACCGTTATGGGGCGTGTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI14367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95119548..95119811 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015714 (Lass2) NM_029789 LAG1 homolog, ceramide synthase 2 Gene [Source:MGI (curated);Acc:Lass2-001]


Sequence tag IST12529D6BBF1
Sequence
CTAGAAGCCCCTGCGGGCCCGCGTGCGTCCTGGGGCCTGAGTGTGGAGGCCGAGGAGGAACGGTGGCGGCCCCTGCTGTT
GCTGCTGTTGCTGCTACTGCTACCGCCGCCGCTGCCGCCTCTGTTTCTGACCCCCTTGTGCCCATCCCAAGAGGGAGGTC
AGAGTGTCCATGTGCCTAACGGGAAACAGGAAGGAGTACACTCTTTANTGTCTGTCCCGGCCCCAAAGGGCTCACATTCC
TATACCGTTATGGGGCGTGTTTGGCCAGCTCTGGGTTGTAACTTGCTAATTACAGGCCCAGANGCCCTCAAGTTAGTTGG
CTACCTGCAGGTGGGTGGCATTTCTTTTTAGCCTGAGCTTGGGAATTCCTGTGCCTAAGCTGCACTCCTGGCATCCAAAC
CAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI14367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95119548..95119954 403
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015714 (Lass2) NM_029789 LAG1 homolog, ceramide synthase 2 Gene [Source:MGI (curated);Acc:Lass2-001]

 
Come back to gene ENSMUSG00000015714


For any suggestions or comments, please send an email to unitrap@crg.es