Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14843C11
Clone ID IST14843C11
Vector VICTR76
Project tigm

Sequence tag IST14843C11HMR1
Sequence
CTACTTCTCCTTTTTCCTCCTCCCCAGATGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14843C11BBF1
Sequence
AAAGTTACTTGTTTCATAACCACCGTGCAGTGGCCAATATCCACTGACTTCAGGTTGCACTTGCAGCTGAGGTGAGTGGC
CTGCTCCGGGTTTGTTAGTGTAGTAGCTAGCGTTGGGTGTGTTGCACACTANANAACTTACCTTTTTAAANCTTGNNGAC
ANNCNNNCGGNNGGNNNCNTCCNNNGN
Sequence Type genomic DNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27937928..27938088 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]


Sequence tag IST14843C11HMF1
Sequence
AAAGTTACTTGTTTCATAACCACCGTGCAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27938056..27938088 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]

 
Come back to gene ENSMUSG00000056692


For any suggestions or comments, please send an email to unitrap@crg.es