Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11637E3
Clone ID IST11637E3
Vector VICTR76
Project tigm

Sequence tag IST11637E3HMR1
Sequence
ANTGAAGCAGNCACACAGTCCTCAGACTCCCCGGANAAAGTGCCCTGGGGCTCTTTGTTTGGAAACATTCTTGGATCCTC
AGGTGTCTGAGGCACTTCCCCTCCCCANAGGATGCTCTTCAAGTACAATCCAAGTTAATGCTTTCATTTATTTATTTATT
TATTTATTTATGTTTTGAATGGGTGGGCTATGAACTGTANGACAGAGGGGGACNACCTACCTCCCACCCCAAACCTCCGG
CGCTCATATTACGGGGCGGGGACCAANGGGCTCTTTGCCTANGTCATTCTGAGCCCATGGGAGGGAGGGTGCTTCTTGGC
TCTAAAGANNCTTTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108363348..108363681 314
NO GENE  


Sequence tag IST11637E3HMF1
Sequence
GTATTCAAGGGTCTCAGCACTAGAAAGGTTGAGAAACACTGCTCTAAGCCTTTACATACTGTCCCTTCCTGCCTATTTGC
TCTCCCTAGAGTACAGATGGAGAAAGGTGTGTTTCGAGGAAATTGAGTAACTGTTATGTATCTTAAAAAGCAGTTTCAGG
ATGTCAGTGGAAACAGTTCCCACTCTTTGAAATTTAAACTAAGTGGAAAGTAACAGTGAAAATTTCCACTGTAAATTCAA
NAACAANTNTGTGAGCNNTAAGGAANAANGANGGAAAATCTATTCTTACNTTCTGTATTCCCTGTGAGGGCCATANGGCA
AAGTAGGTTTTCATGGAGGACTCACCCCAGACATGGTTTTCCTGCAACATANCCCTTTTTCATAAATACATCTTANTTGT
CNNCAGCGTGCTAAGTCATCNAAAAGTTGATTCTGTGTAAAGTCTTATCNNAAAATCTTTAACTTCTAAATAAACTGANA
CCTTAACCTGTANNTA
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20566110..20566601 456
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es