Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15071F5
Clone ID IST15071F5
Vector VICTR80
Project tigm

Sequence tag IST15071F5HMF1
Sequence
TTGGCACAGTAAAGGATTGANTAAAGGACCCCACACAAGCTGGGCAAGCATTTTATCACAACTACATCCAAAGCCCAAGG
TGCATTTATTTTGAATGTGTGGAACATACTATGTGATTATTCTTTTANGTCCTGCTANAAAGCAAAAACCCCACANAATT
ATAATAATTCCACTATTTGGAGAGTTAAGGANATGATTGTTGAAAGGAAANTAACTGCTTTAAAAGANGGACGGGCTGGA
AAAATGGCTCANTGGTTGANANCANGCCCAAAAGATCCTGAGTTCAATTTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103208439..103208730 270
NO GENE  


Sequence tag IST15071F5HMR1
Sequence
CTGGTCTCGAACTCAGAAATCTGCCTGCCTCTGCCTCTGTGTCCTGAGTTCTAGGATTAAAGGCGTACACCTCCACAGAT
TTCACCTCTGGTTCTAGAACTCTAAAAAGACTCACATGGCACATTACTGGGCAGACACTCTGCACCATGCCATGCCAAAG
GCATTTATTTCACTTGAGTTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71020779..71020962 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es