Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10834C10
Clone ID IST10834C10
Vector VICTR76
Project tigm

Sequence tag IST10834C10HMF1
Sequence
AGTCCTCTGCCNCTCCTGTCCGCTGGGCCTGCTGGAGCACAGGACCCATACCANCNAAAGTGTTTTCTCACCTCCACCAG
GCCCCTAAGTCCCGACCATAAGTTAAAGTGTTCCTTCCCTACCAAGTATAAGGCTCAGCTCCAAGGCAGGACTCTTCTAG
GATTCCCACCCNNNGCCTGAGCTAANGGGGAAGAAAGANCTGGNNTGGGAGGAATGAAAGAAGAGGGGTGGAGGGAACCT
CANAGGCTCCATTTACAAGTGAATGGGGGTAAGAATGGAGCAGTTTGTGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29691255..29691543 267
NO GENE  


Sequence tag IST10834C10HMR1
Sequence
TAAAGGAGCAAGCCCTGTGCCTGTGTGTTCACCGAGGCTGGATAAGGTTCTGCTGCAGCCAGGATTTGCTGTCAGGGATG
ACTCTCCAGCTCTGAGGGACTGGTATTGACACTCTAAGAAAGTGGTTTCTTCCTAACGTTGTGACACTTTAATACAGTTC
CTCATGTTGTGGTGGCCCCANCCATACTTGATAACTGTAATTTTGCTACTGTTATGAATTGTAATATANATGTCTGCTAT
GCNNGATATCTGCNATGCTACCATGACCCACAGATTGANAGCCACTGNTNNGANCCNTGN
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29691569..29691867 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es