Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14010D2
Clone ID IST14010D2
Vector VICTR74
Project tigm

Sequence tag IST14010D2BBF1
Sequence
CTTGAACATCNNGAAACGGTCTCCATATCCTTCCNAACNGGAAGGATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14010D2HMF1
Sequence
CTTGAACATCAGGAAACGGTCTCCATATCCTTCCAAACAGGAAGGATCCAGGTAAACAGCCTCTCGCAGGAACTGCAGGC
CATGTGTGGGGGAGGGGATTACCCCTGGTGGCTGTGTTCTGCCCTGTAGTTTTGTAGGATCCCCTGCCAGTGACTCATGC
GCTTTTTACTGCTTCTGAGTAGTAAATACCTTCCCTCCCACCNNNTCCTAAGAGCTGAANAANANACCGGTNNAATCN
Sequence Type genomic DNA
Unitrap ID UNI31481

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13565278..13565514 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033961 (Zfp446) NM_175558 zinc finger protein 446 Gene [Source:MGI (curated);Acc:Zfp446-001]

 
Come back to gene ENSMUSG00000033961


For any suggestions or comments, please send an email to unitrap@crg.es