Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635F4
Clone ID IST14635F4
Vector VICTR74
Project tigm

Sequence tag IST14635F4BBF2
Sequence
AGCTGACTACTACTTCCTTGTTGTTTGTTTGTTTTTTTTCGAGACAGAGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAAC
TCACTTTGTAGACCAGGCTGGCCTTGAACTCAAAGATCCACCTGCTTCTGCCTCAAGTGCTGGGATTAAAGGCGTGTGTC
ACCATGCCTGGCTTTCTTTACAGTTTTCGACTACACTAGTTCTAGAGATTTCTCTTTGTTTTGTGGTGACATAATTTAGA
GTCCTAGGCACGCTAGCTGAGCACTTTACCCCTGAGCTACATCCCCAGCCCTTTGCATGGCATGGCTTTTGGTAGCAGCT
CTATTAAGATAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI21090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69502369..69502704 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es