Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0001
Clone ID AF0001
Vector pGT0lxr
Project sanger

Sequence tag AF0001
Sequence
AGACGGGGAAGAAGATGACACAGAAGAAGCAAAGACCTTAATTGTGGAGCCTCATGTTATTCCTAATAGAGGCCCTTATC
CTTACAACCAGCCCAAACGTAATACAATCCAGTTCACTCATACACAGATAGAGGCCATCCGGGCCGGAATGCAGCCTGGA
CTCACCATGGTTGTGGGCCCACCTGGTACAGGAAAAACAGATGTTGCAGTCCAGATCATATCCAACATTTACCACAATTT
CCCAGAACAGAGGACTTTAATTGTTACTCATTCCAATCAGGCTCTGAACCAGCTGTTTGAGAAAATCATGGCTTTAGACA
TTGATGAGCGCCATCTCCTGCCTCTGGGTCATGGAGAAGAAGAGCTAGAGACAGAGAAAGACTTTAGCAGGTATGGAAGA
GTTAATTATGTCCTAGCTCGAAGAATAGAACTTTTAGAAGAAGTCAAACGGTTACAAAAGAGTCTGGGGGTTCCCGGAGA
TGCTTCGTATACCTGTGAAACTGCCGGCTATTTCTTCTTATATCAG
Sequence Type mRNA
Unitrap ID UNI2876

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 113945646..113953347 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040383 (Aqr) NM_009702 aquarius Gene [Source:MGI (curated);Acc:Aqr-001]

 
Come back to gene ENSMUSG00000040383


For any suggestions or comments, please send an email to unitrap@crg.es