Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11994D6
Clone ID IST11994D6
Vector VICTR76
Project tigm

Sequence tag IST11994D6BBF1
Sequence
GGGATGACATTGGATACAGACATGGTGGACAGCATGAAGTGATGAGAAGAATCCTGTAAATCACTAAGCATCAACTTTAG
GCTGAGTGGATGGAGCGTCACATTTCTGTAAAGTGATANGCTGTTATTTAAAAAAAAACATGAGGAATGAGTGTTTGGTA
CTGANAATGGGGCTCTCGTGAGTATTTCNATCTCTCANANAGCACTTCTGGCCACTTAATANACCANTTGCANCTGGGTT
TTCANATGTGGATTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84778591..84778849 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


Sequence tag IST11994D6HMF1
Sequence
GGGATGACATTGGATACAGACNTGGTGGACANCATGAAGTGATGAGAAGAATCCTGTAAATCACTAAGCATCAACTTTAN
GCTGAGTGGATGGAGCGTCACATTTCTGTAAAGTGATANGCTGTTATTTAAAAAAAAACNTGANGAATGAGTGTTTGGTA
CTGANAATGGGGCTCTCGTGAGTATTTCNATCTCTCANANAGCACTTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es