Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14625C1
Clone ID IST14625C1
Vector VICTR74
Project tigm

Sequence tag IST14625C1HMR1
Sequence
TTACTACCCTGATATTTCTGTTTGTAACTGGTGTTTCTCAATGGATGGAGCTGCCTCTGCTAACCTATAAAGTGAACTGC
CAATTTCCAGACAACACAGACAGGACTTAATCCAGAGAATCATTTCTAAACAGGTCCACTTTCCCTGTATCCTTTCTTTT
CCNCTACCTCTGGTGGATGGTGGGCTAAAGGGAGGTTAAAACATTTTAAAACCATCATTAAAAATCGTGTTTTAAAGCCG
GGCGTGGTGGCACACGCCTTTAATCCGANCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGAGTTCAAGTCTACAAAGT
GAGTTCCAGGACAGCCAGAGCTATACAGAGAAACCCTGTCTCGGAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI12986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120710490..120710867 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]


Sequence tag IST14625C1BBF1
Sequence
GTAGCAGCAGTGTCACGGCCTAATAGGAACAGACAGGCATCAGCCTTAGCTCAAGTCAGCAGGAGGGACCTGGAGGAATA
CCAGGAGGAGTTCTCAGGGTTAGGCTGTGACTCTCTCAGGGAAGCGAAGACCAACGAAGACATGAGACCCACAGGCAGTA
CACAGCTAGTTCTATAAGCAAGCCAAGCTCAGCCTTGGTCATTGTCCGTTGAGTCCTATTTATACTGTCTAAACATGTGT
CTTCTACAGGTCTTGTCTCAGCATGTGGGTCTGTCACAGCTGACATCACTCTGTCAATCACCCCAAGTCCACTCAAGGGA
CAAGAAACTGTGGCACACCACCAGAAGTTTTTTTGTTTTTGTTTTTTGCTGTATTTCTTTCTATTGAGTCCCGATAAATA
CAGCTCANCTACACAATATAAGACAGACCANTACNTGTGTGTCCTTAATAAAAAAAATCTTTCACCNNNCNTCCTTTNNN
GTGCTTGCTTTAACNAANCACCTTTTTANCNATGCCTGCTTCNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120710865..120711386 494
 
EST/CDNA Est Name
  CK389697.1 - CJ301090.1 - AI391094.1

 
Come back to gene CK389697.1 - CJ301090.1 - AI391094.1


For any suggestions or comments, please send an email to unitrap@crg.es